View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_high_63 (Length: 233)
Name: NF1500_high_63
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_high_63 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 32280771 - 32280973
Alignment:
| Q |
17 |
aatagtcgcatttgatatcatggatgtatgtaatgcannnnnnnnattatggtgaaatttttatcattaccttaaagtgtgaaattggtcactttggttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32280771 |
aatagtcgcatttgatatcatggatgtaggtaatgcatttttt---ttatggtgaaatttttatcattaccttaaagtgtgaaattggtcactttggttt |
32280867 |
T |
|
| Q |
117 |
ttatttgtcttacaacaaaaatagagaagttttgtggtgtgggttcactttttagatcttagacttggtattttactatgaatgtgttctgttggccttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32280868 |
ttatttgtcttacaacaaaaatagagaagttttgtggtgtggattcactttttagatcttagacttggtattttactatgaatgtgttctgttggcgttt |
32280967 |
T |
|
| Q |
217 |
gcttct |
222 |
Q |
| |
|
| |||| |
|
|
| T |
32280968 |
gtttct |
32280973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University