View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_27 (Length: 336)
Name: NF1500_low_27
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 14 - 319
Target Start/End: Complemental strand, 38066508 - 38066203
Alignment:
| Q |
14 |
agacaaaaaccaaatgcccgacgtggtggccaacaccgctatcattgaagcttatgccaatgctggtcaaccaaaagaagctcttaaagcttacatgcgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38066508 |
agacaaaaaccaaatgcccgacgtggtggccaacaccgctatcattgaagcttatgccaatgctggtcaaccaaaagaagctcttaaagcttacatgcgt |
38066409 |
T |
 |
| Q |
114 |
atgcttgcttctggggtttgtcctaatgcttatacctacactgttcttgttaagggacttgcatctgatgctaagtttttgaaggatgcgaagaagtatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38066408 |
atgcttgcttctggggtttgtcctaatgcttatacctacactgttattattaagggacttgcttctgatgctaagtttttgaaggatgcgaagaagtatt |
38066309 |
T |
 |
| Q |
214 |
tgttggagatgatggagaaagggatgagacctaatgctgagacttatggtgcagtgtttgagggattggttacggaggagaagatcgatgaggcggagaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38066308 |
tgttggagatgatggagaaagggatgagacctaatgctgagacttatggtgcagtgtttgagggattggttacggaggagaagatcgatgaggcagagaa |
38066209 |
T |
 |
| Q |
314 |
gttgct |
319 |
Q |
| |
|
|||||| |
|
|
| T |
38066208 |
gttgct |
38066203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University