View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_30 (Length: 330)
Name: NF1500_low_30
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 2129425 - 2129733
Alignment:
| Q |
19 |
atattctcttatgtaagatgaatttcatgcagaaacacaaaactttccacttctagcatttcatctcaacaaaccaatgaggccatagatcatagataca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2129425 |
atattctcttatgtaagatgaatttcatgcagaaacacaaaactttccacttctagcatttcatcacaacaaaccaatgaggccatagatcatagataca |
2129524 |
T |
 |
| Q |
119 |
atggtggttgatttatgatcaaccaccattttcactctagcctccttccatgggaagatc------------aaaaggtcgtagccgaggtcagcacatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2129525 |
atggtggttgatttatgatcaaccaccattttcactctagcctccttccatgggaagatcaggaggtcgtcgaaaaggtcgtagccgaggtcagcacatc |
2129624 |
T |
 |
| Q |
207 |
cgtgacagtgtccatggcggaaaccccttgcccaccagttctctactaggcactgaaacgaaaaaattgcttcaaaactctatcactttttcatattata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2129625 |
cgtgacagtgtccatggcggaaacccctcgcccaccagttctctactaggcactgaaacgaaaaaattacttcaaaactctatcactttttcatattata |
2129724 |
T |
 |
| Q |
307 |
actcctttg |
315 |
Q |
| |
|
||||||||| |
|
|
| T |
2129725 |
actcctttg |
2129733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 2111217 - 2111310
Alignment:
| Q |
19 |
atattctcttatgtaagatgaatttcatgcagaaacacaaaactttccacttctagcatttcatctcaacaaaccaatgaggccatagatcata |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||| ||||| |||||||| || ||| ||||||||||||||| |||||||||||| |
|
|
| T |
2111217 |
atattctcttgtgtaagatgaatttcatgcagatacacaaaagtttcctcttctagctttccatagcaacaaaccaatgagaccatagatcata |
2111310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 134 - 180
Target Start/End: Original strand, 2111397 - 2111443
Alignment:
| Q |
134 |
tgatcaaccaccattttcactctagcctccttccatgggaagatcaa |
180 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2111397 |
tgatcaaccaccattttcactctaccctccctccatgggaagatcaa |
2111443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 252
Target Start/End: Original strand, 2111446 - 2111488
Alignment:
| Q |
210 |
gacagtgtccatggcggaaaccccttgcccaccagttctctac |
252 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2111446 |
gacagtgtccatggcggaaacccatcgcccaccagttctctac |
2111488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 14148361 - 14148325
Alignment:
| Q |
186 |
cgtagccgaggtcagcacatccgtgacagtgtccatg |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14148361 |
cgtagccgaggtcagcacctccgtgacagtgtccatg |
14148325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University