View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_46 (Length: 267)
Name: NF1500_low_46
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_46 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 30874800 - 30874545
Alignment:
| Q |
14 |
atatagacacaacaatttaacttcatcccatgattttaaaagtctacaattaactataattaatgtggttttcaaagagattaataaataaata--aact |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
30874800 |
atatagacacaacaatttaacttcatcccatgattttaaaagtctacaattaactataattaatgtagttttcaaagagattaataaataaatataaact |
30874701 |
T |
 |
| Q |
112 |
tacattgtttaatcccaccatgaatattttattgttatgaatactttcctagttgtgagaatggtcgcaagttccaccactttatttgtttctctgtctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874700 |
tacattgtttaatcccaccatgaatattttattgttatgaatactttcctagttgtgagaatggtcgcaagttccaccactttatttgtttctctgtctc |
30874601 |
T |
 |
| Q |
212 |
tctctttccccttccaatctcatcctattccgttttctctgcagtactcaattgat |
267 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874600 |
tctcttttcccttccaatctcatcctattccgttttctctgcagtactcaattgat |
30874545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University