View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_47 (Length: 263)
Name: NF1500_low_47
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 2422277 - 2422048
Alignment:
| Q |
16 |
aaaaggacatgcatttgtacattgaacaccttttctttgaaatatatcccttgttgaaaggaaacctttcacaactcgccacaataatattttaactctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2422277 |
aaaaggacatgcatttgtacattgaacaccttttctttgaaatatatcccttgttgaaaggcaacctttcacaactcgccacaataatattttaactctt |
2422178 |
T |
|
| Q |
116 |
tgtggtatcttcaaccttcatagcttaccccaatcactcggaatttgatacttctcattatcaatgagtgtttccattgcaaacaagcattcatatttta |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2422177 |
tgtggtatcttcaagcttcatagcttaccccaatcactcggaattcgatacttctcattatcaatgagtgtttccattgcaaacaagcattcatatttta |
2422078 |
T |
|
| Q |
216 |
cggtgtacatgtctttgttattgtatttcc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2422077 |
cggtgtacatgtctttgttattgtatttcc |
2422048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 34407351 - 34407319
Alignment:
| Q |
16 |
aaaaggacatgcatttgtacattgaacaccttt |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
34407351 |
aaaaggacatgcatatgtacattgaacaccttt |
34407319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University