View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_48 (Length: 260)
Name: NF1500_low_48
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 158 - 196
Target Start/End: Complemental strand, 21268585 - 21268547
Alignment:
| Q |
158 |
ttatttccaccatttccacccttatttttcttcttctgt |
196 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21268585 |
ttattcccaccatttccacccttatttttcttcttctgt |
21268547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University