View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_52 (Length: 252)
Name: NF1500_low_52
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 46089563 - 46089339
Alignment:
| Q |
13 |
cagaagccatttcacgaaccaaaccactaattggtgttgcaagctcaatgagaaaagctggttgtgaagtagggtctttctgaaaagcgaaatgaacatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46089563 |
cagaagccatttcacgaaccaaaccactaattggtgttgcaagctcaatgagaaaagctggttgtgaagtagggtctttctgaaaagcgaaatgaacatg |
46089464 |
T |
|
| Q |
113 |
gccacgacggtaaccaaagagggttccaacaacacgtgaaccaagaccagagggtagatttgaacggtttttgctgaatactgttaaaacagaacgtatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46089463 |
gccacgacggtaaccaaagagggttccaacaacacgtgaaccaagaccagagggtagatttgaacggtttttgctgaatactgttaaaacagaacgtatt |
46089364 |
T |
|
| Q |
213 |
cttgaaattgctacggtttgtagct |
237 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
46089363 |
cttgaaattgctacggtctgtagct |
46089339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 174 - 237
Target Start/End: Complemental strand, 46525189 - 46525126
Alignment:
| Q |
174 |
gaacggtttttgctgaatactgttaaaacagaacgtattcttgaaattgctacggtttgtagct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| || | ||||||||||||||||| |||||||||||| |
|
|
| T |
46525189 |
gaacggtttttgctgaatactgttaaaatagtaagtattcttgaaattgcttcggtttgtagct |
46525126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 157
Target Start/End: Original strand, 24009799 - 24009943
Alignment:
| Q |
13 |
cagaagccatttcacgaaccaaaccactaattggtgttgcaagctcaatgagaaaagctggttgtgaagtagggtctttctgaaaagcgaaatgaacatg |
112 |
Q |
| |
|
|||| |||||||| |||||||| || || || ||||||||||||||||| | ||| ||| ||| ||||| || || || ||||| || ||||| ||||| |
|
|
| T |
24009799 |
cagatgccatttctcgaaccaagccgctgatcggtgttgcaagctcaatcaaaaaggcttcttgggaagttggatccttttgaaatgcaaaatgtacatg |
24009898 |
T |
|
| Q |
113 |
gccacgacggtaaccaaagagggttccaacaacacgtgaaccaag |
157 |
Q |
| |
|
||||| | ||| || ||||| |||||||| ||||| |||||||| |
|
|
| T |
24009899 |
cccacgtctgtatccgaagagtgttccaactacacgagaaccaag |
24009943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University