View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_62 (Length: 239)
Name: NF1500_low_62
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_62 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 133
Target Start/End: Original strand, 25047792 - 25047912
Alignment:
| Q |
17 |
cttacatatattatgcattgtctatatatcagttgagctaagctcataaagaccaaagatggtataact-----ttaaatacgggaagagtattaagaag |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||| || ||||||||||||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
25047792 |
cttacatatattatgcattgtccatatatcagttgaactaagttc-taaagaccaaagatgatataacttaaaataaaatacgggaagagtattaagaag |
25047890 |
T |
|
| Q |
112 |
aagatacagtgtttaatccata |
133 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25047891 |
aagatacagtgtttaatccata |
25047912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University