View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_70 (Length: 232)
Name: NF1500_low_70
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 31 - 223
Target Start/End: Original strand, 52113520 - 52113712
Alignment:
| Q |
31 |
tctattggagtaattggagttnnnnnnnatgtcttatctgggttggacactgatgctttcaatggagtgactgaaattggaatgaaaggacatttggaaa |
130 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52113520 |
tctattggagtaattggaattggggaggatgtcgtatctgggttggacactgatgctttcaatggagtcgctgaaattggagtgaaaggacatttggaaa |
52113619 |
T |
|
| Q |
131 |
tggagcagcgattgcggtgttttatcgttctttttaatgcaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgatg |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113620 |
tggagcagcgattgtggtgttttatcgttcttttaaatggaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgatg |
52113712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University