View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1500_low_70 (Length: 232)

Name: NF1500_low_70
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1500_low_70
NF1500_low_70
[»] chr3 (1 HSPs)
chr3 (31-223)||(52113520-52113712)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 31 - 223
Target Start/End: Original strand, 52113520 - 52113712
Alignment:
31 tctattggagtaattggagttnnnnnnnatgtcttatctgggttggacactgatgctttcaatggagtgactgaaattggaatgaaaggacatttggaaa 130  Q
    |||||||||||||||||| ||       ||||| ||||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||||||||||    
52113520 tctattggagtaattggaattggggaggatgtcgtatctgggttggacactgatgctttcaatggagtcgctgaaattggagtgaaaggacatttggaaa 52113619  T
131 tggagcagcgattgcggtgttttatcgttctttttaatgcaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgatg 223  Q
    |||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
52113620 tggagcagcgattgtggtgttttatcgttcttttaaatggaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgatg 52113712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University