View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_72 (Length: 229)
Name: NF1500_low_72
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 35037216 - 35037432
Alignment:
| Q |
13 |
aaaatctaatattaattatgatctcattattttcaaatagtctaatatatttagtgattaaatattcgttgttgtaatagactatttaataatcttgtaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
35037216 |
aaaatctaatattaattatgatctcattattttcaaatagtctaatatatttagcgattaaatattcgttgttgtaatagactattgaataatcgtgtaa |
35037315 |
T |
|
| Q |
113 |
acnnnnnnnnnngactatttaatgatcgtatatatacaaatctataatag-----aaatggatgaagaattgagtaatacattggttttatattagattg |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037316 |
acaaaaaaaaaagactatttaatgatcgtatatatacaaatctataatagaaattaaatggatgaagaattgagtaatacattggttttatattagattg |
35037415 |
T |
|
| Q |
208 |
gttttagattgtgcatg |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35037416 |
gttttagattgtgcatg |
35037432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University