View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_74 (Length: 227)
Name: NF1500_low_74
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_74 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 31544219 - 31543987
Alignment:
| Q |
1 |
tttagtacactgttagtgaccaaataagcatgaaaacattgccccaacaatcagttttgtactatttttccatcctcatcattgtca---ttcc---aac |
94 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || | ||| |
|
|
| T |
31544219 |
tttagtgcactgttagtgactaaataagcatgaaaacattgccccaacaatcagttttgtactatttttccatcctcatcattgtaacggttactataac |
31544120 |
T |
|
| Q |
95 |
ttatggagagaaagatgcagattacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctagcaacattcactactgcaaatggaac |
194 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31544119 |
taatggagagaaagatgcagattacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctggcaacattcactactgcaaatggaat |
31544020 |
T |
|
| Q |
195 |
ggcatcacgtgcgaccaatctaatcaagttgtc |
227 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31544019 |
ggcatcaggtgtgaccaatctaatcaagttgtc |
31543987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 115 - 199
Target Start/End: Complemental strand, 31535449 - 31535365
Alignment:
| Q |
115 |
attacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctagcaacattcactactgcaaatggaacggcat |
199 |
Q |
| |
|
||||||||||| ||||| |||||||||| |||||||||||| |||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
31535449 |
attacatgtccaaacttttgaaagcactaaccccaactccctctaactggtctaacaacactcactactgcagatggaacggcat |
31535365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 192
Target Start/End: Original strand, 31550579 - 31550656
Alignment:
| Q |
115 |
attacatgtcccaacttatgaaagcactgaccccaactcccaaaggctggtctagcaacattcactactgcaaatgga |
192 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||||||||||| |||||||||| ||||| ||| ||||||| |||| |
|
|
| T |
31550579 |
attatatgtcccaacttttgaaagcattgaccccaactccttctggctggtctaacaacactcatcactgcaattgga |
31550656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University