View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_low_77 (Length: 225)
Name: NF1500_low_77
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_low_77 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 21782167 - 21781948
Alignment:
| Q |
6 |
aataataaattacctcgtgcataagaccagacaccacaaaagttgccaacgtggcagctgaagtggcatatgtggaacccacataagacctaatgatgtg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21782167 |
aataataaattacctcgtgcataagaccagacaccacaaaagttgccaatgtggcagctgaagtggcatatgtggaacccacataagacctaatgatgtg |
21782068 |
T |
 |
| Q |
106 |
gcgaacaggattgtatacgatggggcgtaagataccagttaccattaggttccacctacgaccccaaaagtcttgaagcgacgtggacaaataaggttcg |
205 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21782067 |
gcgaacgggattgtatacggtgggacgtaagataccagttaccattaggttccacctacgaccccaaaagtcttgaagcgatgtggacaaataaggttcg |
21781968 |
T |
 |
| Q |
206 |
ttgaattgtggttcgatttc |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21781967 |
ttgaattgtggttcgatttc |
21781948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University