View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15011_low_3 (Length: 247)
Name: NF15011_low_3
Description: NF15011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15011_low_3 |
 | |
|
| [»] scaffold0121 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0121 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 28488 - 28566
Alignment:
| Q |
160 |
tatagggttgttaagttaggatatcaaatctagttgatgataatgtgtttcacttttatattgtttcattcatctcact |
238 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28488 |
tatagggttgttaagctgggatatcaaatctagttgatgataatgtgtttcacttttatattgtttcattcatttcact |
28566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 28342 - 28426
Alignment:
| Q |
17 |
agggtttgaatgatgtggagagnnnnnnngcttgtttgaatggcgagaatgtgaaggaaagtggtgaacaagttcttagacttag |
101 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28342 |
agggtttgaatgatgtggagagtttttttgcttgtttgaatggtgagaatgtgagggaaagtggtgaacaagttcttagacttag |
28426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University