View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15012_high_2 (Length: 310)
Name: NF15012_high_2
Description: NF15012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15012_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 43267957 - 43268216
Alignment:
| Q |
1 |
gtgtaatgcaattgaacaagctgatggtggtggaaaattcaaagaagatgtctggtcaagacctggtggtggtggtgggattagtagagttcttcaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43267957 |
gtgtaatgcaattgaacaagctgatggtggtggaaaattcaaagaagatgtttggtcaagacctggtggtggtggtgggattagtagagttcttcaagat |
43268056 |
T |
 |
| Q |
101 |
ggtgctgtttgggagaaagctggtgttaatgtttctgttgtgtatggtcaaatgccacctgatgcttatcgtgctgctaagggtgctgccgccggttcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43268057 |
ggtgctgtttgggagaaagctggtgttaatgtttctgttgtgtatggtcaaatgccacctgatgcttatcgtgctgctaagggtgctgccgccgcttcca |
43268156 |
T |
 |
| Q |
201 |
gtgatcagaagcccgggcctattccnnnnnnngcagccggaattagctctgtaagtatcc |
260 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43268157 |
gtgatcagaagcccgggcctattccttttttcgcagccggaattagctctgtaagtatcc |
43268216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University