View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15012_low_9 (Length: 205)
Name: NF15012_low_9
Description: NF15012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15012_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 190
Target Start/End: Complemental strand, 28848003 - 28847827
Alignment:
| Q |
14 |
agatgaagctttaagaccgggtgtctatgctttgatagatgcttgcttagttgatgatcttcaatatcttcatactgtttttggaggtaagcaatcttga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28848003 |
agatgaagctttaagaccgggtgtctatgctttgatagatgcttgctcagttgatgatcttcaatatcttcatactgtttttggaggtaagcaatcttga |
28847904 |
T |
|
| Q |
114 |
caagaacaaattctagcgaagtaattaaaggaagaatctaatttcgattttttccttcattttgtagagggaccttg |
190 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28847903 |
caagaacaaattctagcgaagtacttaaaggaagaatctaatttcgattttttccttcattttgtagagggaccttg |
28847827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University