View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15013_low_6 (Length: 350)
Name: NF15013_low_6
Description: NF15013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15013_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 47625762 - 47626092
Alignment:
| Q |
1 |
gttttctttccaagttgttttgttaggtttgaaacttatccgttttatcagcattcagagacctcagcagcagcagcaacaactaagggttagtttattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47625762 |
gttttctttccaagttgttttgttaggtttgaaacttatccgttttatcagcattcagagacctcagcagcagcaacaacaactaagggttagtttattt |
47625861 |
T |
 |
| Q |
101 |
atatgatgtttctattaatccataattagcatctttgaccctagtaagcgcgccaaaatatctttatggcttagactctttgagcctgccataagattaa |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625862 |
atatgatgattctattaatccataattagcatctttgaccctagtaagcgcgccaaaatatctttatggcttagactctttgagcctgccataagattaa |
47625961 |
T |
 |
| Q |
201 |
tcctcggatcgaacatccaaacttttttcacgtggaattgcgatacctatcaaatcggctattatagtaatctaatttagtcatgctatcaattttacca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625962 |
tcctcggatcgaacatccaaacttttttctcgtggaattgcgatacctatcaaatcggctattatagtaatctaatttagtcatgctatcaattttacca |
47626061 |
T |
 |
| Q |
301 |
aggttataagttgcaataatggttgcaaatg |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47626062 |
aggttataagttgcaataatggttgcaaatg |
47626092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University