View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15014_high_4 (Length: 282)
Name: NF15014_high_4
Description: NF15014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15014_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 274
Target Start/End: Complemental strand, 3945702 - 3945448
Alignment:
| Q |
20 |
ttatggtttatcaagtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945702 |
ttatggtttatcaagtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcct |
3945603 |
T |
|
| Q |
120 |
cagatgaatactattggattaggcttttcatccgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945602 |
cagatgaatactattggattaggcttttcatctgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggtt |
3945503 |
T |
|
| Q |
220 |
caatctttagttcttcttctgtaccaagtaatgcatcagttatgccctctctgct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3945502 |
caatctttagttcttcttctgtaccaagtaatgcatcagttatgccttctctgct |
3945448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University