View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15014_low_7 (Length: 249)
Name: NF15014_low_7
Description: NF15014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15014_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 3945392 - 3945152
Alignment:
| Q |
1 |
aatttggggaatggaagtgagaaaggaatgaagaaagatgaaggagagatggagcatgtgggtggtttgtatgatccagctgcttcttcactttactgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945392 |
aatttggggaatggaagtgagaaaggaacgaagaaagatgaaggagagatggagcatgtgggtggtttgtatgatccagctgcttcttcactttactgga |
3945293 |
T |
|
| Q |
101 |
atacagcatcatcatcagctattggtgtttggaacgatcaagcttctaatattggttcatcagttacttctttgatctagagtgaacaataaacttaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3945292 |
atacagcatcatcatcagctattggtgtttggaacgatcaagcttctaatattggttcatcagttacttctttgatctagagtgaacaataaactcaatc |
3945193 |
T |
|
| Q |
201 |
ctcagttcaagttcaaggtcatc-ttaatttggtacctttg |
240 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3945192 |
ctcagttcaagttcaaggtcatctttaatttggtacctttg |
3945152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University