View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15015_low_5 (Length: 288)
Name: NF15015_low_5
Description: NF15015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15015_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 136 - 271
Target Start/End: Complemental strand, 22326985 - 22326850
Alignment:
| Q |
136 |
taacagtaaattaagggtatagggaagaggaattcattctggccctataagaaagaggcttttgatgatgatggcagtgacaaagggtggcagtgtttgg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22326985 |
taacagtaaattaagggtatagggaagaggaattcattctggccctataagaaagaggcttttgatgatgatggcagtgacaaagggtggcagtgtttgg |
22326886 |
T |
|
| Q |
236 |
tcagaatggacgtccgttttatttcatcactgctct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22326885 |
tcagaatggacgtccgttttatttcatcactgctct |
22326850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 6 - 104
Target Start/End: Complemental strand, 22327115 - 22327017
Alignment:
| Q |
6 |
agagagaagaatgagttggttaatacccacttggagaggacgagaaagaggtgtcctgttgtgaaaaatccagcaaattttccatatctcaacacacag |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22327115 |
agagagcagaatgagttggttaatacccacttgtagaggacgagaaagaggtgtcctgttgtgaaaaatccagcaaattttccatatctcaacacacag |
22327017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University