View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15015_low_6 (Length: 288)
Name: NF15015_low_6
Description: NF15015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15015_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 17455201 - 17455464
Alignment:
| Q |
17 |
aaatccacacttcattgcaaaacatagtctttatagacccaatgaattggtataattctttatatcgattctttattaatctctttatttattttttatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17455201 |
aaatccacacttcattgcaaaacatagtctttatagacccaatgaattggtataattctttatatcgattctttattaatcgctttatttattttttatc |
17455300 |
T |
|
| Q |
117 |
atacgcaaaaggtttattaagtgactctccaatgtatttctctaaacatgtcgagttgttgcaatttcagttttcataatttacaactattaaatgttac |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17455301 |
atacgcaaaaggtttattaagtgattctcc-atgtattgctctaaacatgtcaagttgttgcaatttcaattttcataatttacaactattaaatgttac |
17455399 |
T |
|
| Q |
217 |
ttctttgatgtgcttattatggattttgcagcattttccgaagaatgtaattaaggatttctgtg |
281 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17455400 |
ttctttgatgtgcttattatggattttacagcattttccgaagaatgtaattaaagatttctgtg |
17455464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 170 - 237
Target Start/End: Complemental strand, 17393435 - 17393368
Alignment:
| Q |
170 |
agttgttgcaatttcagttttcataatttacaactattaaatgttacttctttgatgtgcttattatg |
237 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||| | ||| |||||||||||||||||| ||||||||| |
|
|
| T |
17393435 |
agttgttgcaattttagttttcttaacttacgatcatttcatgttacttctttgatgtacttattatg |
17393368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University