View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15016_low_13 (Length: 225)

Name: NF15016_low_13
Description: NF15016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15016_low_13
NF15016_low_13
[»] chr3 (1 HSPs)
chr3 (43-137)||(25412499-25412594)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 43 - 137
Target Start/End: Original strand, 25412499 - 25412594
Alignment:
43 taaataaacccaattgggccttgggatcatattagaccaattcatgatcgaa-tttgtacccgcatgcataaccatggacgaaacttttttaccag 137  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
25412499 taaatatacccaattgggccttgggatcatattagaccaattcatgatcgaagtttgtaccagcatgcataaccatggacgaaacttttttaccag 25412594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University