View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15017_low_6 (Length: 261)
Name: NF15017_low_6
Description: NF15017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15017_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 254
Target Start/End: Complemental strand, 48176442 - 48176218
Alignment:
| Q |
20 |
catacgaagctggtgctctcagctgggccctttgttgatttagatttattttaggaagaaaagaagtaaatgaataaacgagaaatnnnnnnn-gaggca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48176442 |
catacgaagctggtgctctcagctgggccctttgt--at---gatttattttaggaagaaaagaagtaaatgaataaacgagaaataaaaaaaagaggca |
48176348 |
T |
 |
| Q |
119 |
attggattatagaataatcacttgtttttatcaattgatatatcattttcaatttccagggtccagagacagcgacccaccaagctgccctcttacccaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48176347 |
attggattatagaataatcacttgtttttatcaattgatatatcattttcaatttccagggtccagagacagcaacccaccaagctgccctcttacccaa |
48176248 |
T |
 |
| Q |
219 |
ccagccatagccatcattgattcatgattcttctca |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
48176247 |
ccag------ccatcattgattcatgattcttctca |
48176218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University