View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15018_high_4 (Length: 330)
Name: NF15018_high_4
Description: NF15018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15018_high_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 85 - 330
Target Start/End: Complemental strand, 2428546 - 2428300
Alignment:
| Q |
85 |
gtcgctgacatgttcttttcttcttctcacacaatttt-atatatatttttctcattgaatttctccagttaggtaacacttcaacttctgctgaatcag |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2428546 |
gtcgctgacatgttcttttcttcttctcacacaatttttatatatatttttctcattgaatttctccaattaggtaacacttcaacttctgctgaatcag |
2428447 |
T |
|
| Q |
184 |
atttcaccatgtgaaacaaagtacaaacaacataaaggtgagtttgtacgtatatctttgtctatcttgttgcaaagtcttattcttttatatttttaac |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2428446 |
atttcaccatgtgaaacaaagtacaaacaacataaaggtgagtttgtacgtatatctttgtctatcttgttgcaaagtctcattcttttatatttttaac |
2428347 |
T |
|
| Q |
284 |
attaattttttcaaactacaaatcatgttttgcatgaccttgctctg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2428346 |
attaattttttcaaactacaaatcatgttttgcatgaccttgctctg |
2428300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University