View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15018_low_3 (Length: 215)
Name: NF15018_low_3
Description: NF15018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15018_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 36508880 - 36508702
Alignment:
| Q |
21 |
atagtaagcactggggtacacgtgatacttgtgcatgctttcttttccatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36508880 |
atagtaagcactggggtacacgtgatacttgtgcatgctttcttttgcatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaa |
36508781 |
T |
|
| Q |
121 |
ccattatatctacaacagccaaaattctaaggctatgtgatgacttggaaggcgacaaggtaggaaaacatcacctatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36508780 |
ccattatatctacaacagccaaaattctaaggctatgtgatgacttggaaggcgataaggtaggaaaacatcacctatg |
36508702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 141 - 196
Target Start/End: Complemental strand, 37339314 - 37339259
Alignment:
| Q |
141 |
aaaattctaaggctatgtgatgacttggaaggcgacaaggtaggaaaacatcacct |
196 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||| |
|
|
| T |
37339314 |
aaaattctaaggttatgtgatgacttggaaagcgacaaggtaagaaaacattacct |
37339259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 130
Target Start/End: Complemental strand, 37339997 - 37339930
Alignment:
| Q |
63 |
ttttccatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccattatatc |
130 |
Q |
| |
|
|||| ||||||| ||| ||||| ||| ||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
37339997 |
ttttacatgggtaaagatataattgaaaaaaccgagtctctaatggacaacttccctaccattatatc |
37339930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University