View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15019_high_4 (Length: 334)
Name: NF15019_high_4
Description: NF15019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15019_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 20 - 320
Target Start/End: Complemental strand, 54774875 - 54774575
Alignment:
| Q |
20 |
ggaagttctcttcttaatatgtattgtaaaactggttttgttttcgatgctcgtaaactgtttgacagaatgcctgagagaaatacggtttcttgggcta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774875 |
ggaagttctcttcttaatatgtattgtaaaactggttttgttttcgatgctcgtaaactgtttgacagaatgcctgagagaaatacggtttcttgggcta |
54774776 |
T |
 |
| Q |
120 |
ctatgatttctgggtatgcttctagtgatattgctgataaggcggttgaggtttttgaacttatgcggcgtgaggaagagattcaaaatgagtttgctct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774775 |
ctatgatttctgggtatgcttctagtgatattgctgataaggcggttgaggtttttgaacttatgcggcgtgaggaagagattcaaaatgagtttgctct |
54774676 |
T |
 |
| Q |
220 |
cactagtgttctaagtgcattgacaagtgatgtgtttgtgtacactggtagacaggttcattcacttgctattaaaaatggtttgcttgccattgtctct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774675 |
cactagtgttctaagtgcattgacaagtgatgtgtttgtgtacactggtagacaggttcattcacttgctattaaaaatggtttgcttgccattgtctct |
54774576 |
T |
 |
| Q |
320 |
g |
320 |
Q |
| |
|
| |
|
|
| T |
54774575 |
g |
54774575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 78 - 115
Target Start/End: Original strand, 30163352 - 30163389
Alignment:
| Q |
78 |
tgtttgacagaatgcctgagagaaatacggtttcttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30163352 |
tgtttgacagaatgcctgagagaaatgtggtttcttgg |
30163389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University