View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15019_high_5 (Length: 329)
Name: NF15019_high_5
Description: NF15019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15019_high_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 19 - 329
Target Start/End: Original strand, 30617384 - 30617695
Alignment:
| Q |
19 |
ccccctaataacccttccaaattaaaatgaaataaaacctataaattatcttccttcttcaagatacatgccaatacatcattttgcaccttgatgac-a |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
30617384 |
ccccctaataacccttccaaattaaaatgaaataaaacctataaactatcttccttcttcaagatacatgccaatgcatcattttgcaccttgatgatga |
30617483 |
T |
|
| Q |
118 |
cactttcttcactctcaaatcatctattcatgcaacaaagtgaaaggaggacaaagagagacattggtagtccttggagcaagtgttggaatagcagttg |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30617484 |
cactttcttcattctcaaatcatctattcatgcaacaaagtgaaaggaggacatagagagacattggtagtccttggagcaagtgttggaatagcagttg |
30617583 |
T |
|
| Q |
218 |
gaacccaatttgatccttgatcaacagataattgttgtggctgatagtacaagttccttgctgcctgtgcatgataaggatcagtagtagtcccaaaaac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30617584 |
gaacccaatttgatccttgatcaacagataattgttgtggctgatagtacaagttccttgctgcctgtgcatgataaggatcagtagtagtcccaaaaac |
30617683 |
T |
|
| Q |
318 |
attttcataacc |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30617684 |
attttcataacc |
30617695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University