View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15019_high_7 (Length: 292)
Name: NF15019_high_7
Description: NF15019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15019_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 232 - 274
Target Start/End: Complemental strand, 3649907 - 3649865
Alignment:
| Q |
232 |
tgaaggtaagattggtcattatatctaaagaagattcgtattt |
274 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3649907 |
tgaaggtaagattgttcattatatctaaagaagattcgtattt |
3649865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 33420713 - 33420642
Alignment:
| Q |
21 |
aggactactaattctagccttgataggagaattagtataaattgttcagttattgcttagcataaacatatt |
92 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
33420713 |
aggactactaaccctaaccttgatgggagaattagtataaattgttcacttaatgtgtagcatagacatatt |
33420642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 135
Target Start/End: Complemental strand, 9618834 - 9618760
Alignment:
| Q |
61 |
attgttcagttattgcttagcataaacatattttaaggataattgtatacttattttggcgtgtttaaaccttca |
135 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| |||||||||| ||||| ||| ||| |||||| ||||| |
|
|
| T |
9618834 |
attgttcagttattgcttagcatcgacatattataaagataattgtaaacttaatttatcgtttttaaatcttca |
9618760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 55 - 113
Target Start/End: Complemental strand, 30039656 - 30039598
Alignment:
| Q |
55 |
gtataaattgttcagttattgcttagcataaacatattttaaggataattgtatactta |
113 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||| ||| ||||| ||||||||| |
|
|
| T |
30039656 |
gtataaattgttcaattattggttagcatagacatattctaaaaataatagtatactta |
30039598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University