View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15019_low_6 (Length: 315)
Name: NF15019_low_6
Description: NF15019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15019_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 6e-74; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 121 - 305
Target Start/End: Complemental strand, 22695704 - 22695520
Alignment:
| Q |
121 |
gcaatttagaaccacgacgcacattgccttcttacatgccaatatgttactcactattgcaatatttttcctccaagaacaatgttaattataggaaaca |
220 |
Q |
| |
|
|||||||| ||||| | | |||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
22695704 |
gcaatttaaaaccatgccacacattgctttcttacatgccgatatgttactcactattgcaatattcttcctccaagaacaatgttaattatatgaaaca |
22695605 |
T |
|
| Q |
221 |
tgaaacaggttataatgacaaagacaatggatttttcggtgtttaattgatgctttatttgttcaaatttactgcaggttctgtg |
305 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22695604 |
agaaacaggttataatgacaaagacaatagatttttcggtgtgtaattgatgctttatttgttcaaatttactgcaggttctgtg |
22695520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 22695854 - 22695746
Alignment:
| Q |
18 |
ttttcatagtatatggctttttgagaaacacatcatagcctacaactgtaattgcggctgcgatataaaggttttagagatctcctctacggcagttgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22695854 |
ttttcatagtatatggctttttgagaaacacatcatagcctacaactgtaattgcggctgcgatataaaggttttagagatctcctctacggcagttgtg |
22695755 |
T |
|
| Q |
118 |
actgcaatt |
126 |
Q |
| |
|
|| |||||| |
|
|
| T |
22695754 |
accgcaatt |
22695746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 34 - 126
Target Start/End: Complemental strand, 22684355 - 22684263
Alignment:
| Q |
34 |
ctttttgagaaacacatcatagcctacaactgtaattgcggctgcgatataaaggttttagagatctcctctacggcagttgtgactgcaatt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| || ||||||| |||||| |
|
|
| T |
22684355 |
ctttttgagaaacacatcatagcctacaactgtaattgcggctgcaatataaaggttttagagatctcctaaacgccaattgtgaccgcaatt |
22684263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 304
Target Start/End: Complemental strand, 22684185 - 22684111
Alignment:
| Q |
229 |
gttataatgacaaagacaatggatttttcggtgtttaattgatgctttatttgttcaaatttactgcaggttctgt |
304 |
Q |
| |
|
|||||||||||||||| |||| |||| | |||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
22684185 |
gttataatgacaaagagaatgaatttg-cagtgtttaattaatgctttatttgttcaaatttaccacaggttctgt |
22684111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University