View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1501_high_16 (Length: 250)
Name: NF1501_high_16
Description: NF1501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1501_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 127 - 232
Target Start/End: Complemental strand, 31737668 - 31737563
Alignment:
| Q |
127 |
aagatttttattaccattgcggtagtctatcatttgaaagggatccaaagtccatggtttttacctcagacaaaaataagttaatcaatactagaccagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31737668 |
aagatttttattaccattgcggtagtctatcatttgaaagtgatccaaagtccatggtttttacctcagacaaaaataagtgaatcaatactagaccagt |
31737569 |
T |
 |
| Q |
227 |
ccagaa |
232 |
Q |
| |
|
|||||| |
|
|
| T |
31737568 |
ccagaa |
31737563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 127 - 231
Target Start/End: Complemental strand, 31703285 - 31703182
Alignment:
| Q |
127 |
aagatttttattaccattgcggtagtctatcatttgaaagggatccaaagtccatggtttttacctcagacaaaaataagttaatcaatactagaccagt |
226 |
Q |
| |
|
||||||||||||||| | || |||||||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
31703285 |
aagatttttattaccgtcacgatagtctatcattggaaagtgatccaaagtccatagtttttacctcggacaaaaataagttaatcaatactaga-cagt |
31703187 |
T |
 |
| Q |
227 |
ccaga |
231 |
Q |
| |
|
||||| |
|
|
| T |
31703186 |
ccaga |
31703182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 37 - 129
Target Start/End: Complemental strand, 31737791 - 31737700
Alignment:
| Q |
37 |
gaacacctaagtagggcattagaagcnnnnnnnntgatcgattttgccctgatattacattagtttatagtaccaatacaaaattttattaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31737791 |
gaacacctaagtagggcattagaagcaaaaaaa-tgatcgattttgccctgatattacattagtttatagtaccaatacaaaattttattaag |
31737700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University