View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1501_low_22 (Length: 227)
Name: NF1501_low_22
Description: NF1501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1501_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 213
Target Start/End: Complemental strand, 32673969 - 32673766
Alignment:
| Q |
10 |
tcatcagttgtagccaaaagactatggaatgtgttgaggatcacattctttatgatgagaaagagtcttgtatcaaagagaaagatgattatggacatga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32673969 |
tcatcagttgtagccaaaagactatggaatgtgttgaggatcacattctttatgatgagaaagagtcttgtatcaaagagaaagatgattatggacatga |
32673870 |
T |
|
| Q |
110 |
atttgatgatgaagaaagggaaagtgctaagaaaatctttgagcaatctcatgtcatcccataatcgtcaccaccatcattcatcgaaaaatggtggtgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32673869 |
atttgatgatgaagaaagggaaagtgctaagaaaatctttgagcaatctcatgtcatcccataatcgtcaccaccatcattcatcgaaaaatggtggtgg |
32673770 |
T |
|
| Q |
210 |
tttt |
213 |
Q |
| |
|
|||| |
|
|
| T |
32673769 |
tttt |
32673766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University