View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15020_high_1 (Length: 484)
Name: NF15020_high_1
Description: NF15020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15020_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 18 - 473
Target Start/End: Original strand, 42812343 - 42812793
Alignment:
| Q |
18 |
acaatcatcaacaacgggattgacatcaggaatatgagcaattaaaccatcagagaaaccatgaccttgatgatcaatagcgcaagtggcgaatccggct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42812343 |
acaatcatcaacaacgggattgacatcaggaatatgagcaattaaaccatcagagaaaccatgaccttgatgatcaatggcgcaagtggcgaatccggct |
42812442 |
T |
|
| Q |
118 |
ttagcaaagtagacggcggagagttggacagtccagctggattcgccggtgtagccgtggacgacggcgagggttccgataagtttagttggaggattag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
42812443 |
ttagcaaagtagacggcggagagttggacagtccagctggattcgccggtgtagccgtggacgacggcgagggttccgatgagtttggttggaggattag |
42812542 |
T |
|
| Q |
218 |
ggatccaccactgagtgaagagtttgagacctcttgagttggttatgaactcggaggtgtgagtcactgagtggcgagtgtagaattcttcaggagttag |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42812543 |
ggatccaccactgagtgaagagtttaagacctcttgagttggttatgaactcggaggcgtgagtcactgagtggcgagtgtagaattcttcaggagttag |
42812642 |
T |
|
| Q |
318 |
ggttccgaaggggctatgatcgttggcttctgctactgggtgcaccattttggatatcttctactatcagttagttatgtgtggatatagttatagtttg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||| | |||||||||||||||||||||||||||| |
|
|
| T |
42812643 |
ggttccgaaggggctatgatcgttggcttctgctattgggtgcaccattttggatattaac-----tcactcagttatgtgtggatatagttatagtttg |
42812737 |
T |
|
| Q |
418 |
agtttcggctataatcagcgtgtcccaactagttcttccacttttctccccttcat |
473 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42812738 |
agtttcggctataatcagcgtgtcccaactagttcttcgacttttctccccttcat |
42812793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University