View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15021_low_2 (Length: 238)
Name: NF15021_low_2
Description: NF15021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15021_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 34820921 - 34821127
Alignment:
| Q |
12 |
gaagaatatcattgggccgtcgtttaccgttatcaactttgttccatgcataatcaaatgtctcgagcatttgagattttactttacaagcttcaccatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34820921 |
gaagaatatcattgggccgtcgtttaccgttatcaactttgttccatgcataatcaaatgtctcgagcatttgagattttactttacaagcttcaccatc |
34821020 |
T |
 |
| Q |
112 |
ggtcttcatctgttcaacaaatagtattgcgcaaataaatcattgaaattaaaaatatttgcaaatcatttgtttaagataaaattttacttgtcttccc |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34821021 |
ggtcttcatctgttcaacaaatggtattgcgcaaataaatcattgaaattaaaaatatttgcaaatcatttgtttaagataaaattttacttgtcttccc |
34821120 |
T |
 |
| Q |
212 |
taaatgc |
218 |
Q |
| |
|
||||||| |
|
|
| T |
34821121 |
taaatgc |
34821127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University