View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15022_high_18 (Length: 258)
Name: NF15022_high_18
Description: NF15022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15022_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 248770 - 249002
Alignment:
| Q |
13 |
gaggtggcttgtaactaagagctcccaagctgtatacacataggttattctcttgttttaatatctgactacttcctgtgctcttcaagaaaggaacatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248770 |
gaggtggcttgtaactaagagctcccaagctgtatacacataggttattctcttgttttaatatctgactacttcctgtgctcttcaagaaaggaacatt |
248869 |
T |
 |
| Q |
113 |
gcaagaataagaagatgatgaagttcctatcaaggttgcttggcagagagacacaatctgtgaattaccatccatggcaattttacagttagttccatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248870 |
gcaagaataagaagatgatgaagttcctatcaagcttgcttggcagagagacacaatctgtgaattaccatccatggcaattttacagttagttccatcc |
248969 |
T |
 |
| Q |
213 |
actgatggtatatctaatttgtatgctccctct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
248970 |
actgatggtatatctaatttgtatgctccctct |
249002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University