View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15022_high_23 (Length: 236)
Name: NF15022_high_23
Description: NF15022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15022_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 52800085 - 52800290
Alignment:
| Q |
14 |
cacaactaaccgacaagtaacttactcaaaacgaaggaatggtcttttcaagaaggctaatgagctcactgttctttgtgatgctaaggtttctattatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800085 |
cacaactaaccgacaagtaacttactcaaaacgaaggaatggtcttttcaagaaggctaatgagctcactgttctttgtgatgctaaggtttctattatt |
52800184 |
T |
|
| Q |
114 |
atgttttccagcactggcaagcttcatgaatacattagcccctccgcctcgtatgtttctttctctaaccctagcttctctatttatctatctagattta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800185 |
atgttttccagcactggcaagcttcatgaatacattagcccctccgcctcgtatgtttctttctctaaccctagcttctctatttatctatctagattta |
52800284 |
T |
|
| Q |
214 |
taatat |
219 |
Q |
| |
|
|||||| |
|
|
| T |
52800285 |
taatat |
52800290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 8201110 - 8201198
Alignment:
| Q |
18 |
actaaccgacaagtaacttactcaaaacgaaggaatggtcttttcaagaaggctaatgagctcactgttctttgtgatgctaaggtttc |
106 |
Q |
| |
|
|||||| | ||||| || |||||||| ||||||||||| | |||||||| || |||| || | |||||||||||||||||||||||| |
|
|
| T |
8201110 |
actaacaggcaagtgacatactcaaagagaaggaatggtatattcaagaaagcacatgaacttagtgttctttgtgatgctaaggtttc |
8201198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University