View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15022_low_16 (Length: 299)
Name: NF15022_low_16
Description: NF15022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15022_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 134 - 287
Target Start/End: Original strand, 52800456 - 52800613
Alignment:
| Q |
134 |
gtcttgttccttagaatatgcaagagaacttgaagaaactgaaagatgtcaataggaatcttcgcaaggagattaggtatataagtattacaaattaatt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800456 |
gtcttgttccttagaatatgcaagagaacttgaagaaactgaaagatgtcaataggaatcttcgcaaggagattaggtatataagtattacaaattaatt |
52800555 |
T |
|
| Q |
234 |
tctttggtgacttattgatccctaaatcatg----tatataaatatgcatatgtgtgt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52800556 |
tctttggtgacttattgatccctaaatcatgtatatatataaatatgcatatgtgtgt |
52800613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 52800323 - 52800403
Alignment:
| Q |
1 |
tgcagaacaaagcagtttttcgatcagtatcagatgactgtaggaattgatctgtggaactctcattatgaggttagatcc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800323 |
tgcagaacaaagcagtttttcgatcagtatcagatgactgtaggaattgatctgtggaactctcattatgaggttagatcc |
52800403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University