View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15022_low_19 (Length: 270)
Name: NF15022_low_19
Description: NF15022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15022_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 77 - 196
Target Start/End: Original strand, 39738186 - 39738305
Alignment:
| Q |
77 |
ctcggttggtagagacattacatatattatatgtaagggttggaagttcgagcctcgaacactctgtttattcatcttataaagataaaattaaactctt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39738186 |
ctcggttggtagagacattacatatattatatgtaagggtcggaagttcaagcctcgaacattctgtttgttcatcttataaagataaaattaaactctt |
39738285 |
T |
 |
| Q |
177 |
ccgaccgttatttgaatttt |
196 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
39738286 |
ccgactgttatttgaatttt |
39738305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 198 - 259
Target Start/End: Original strand, 39738265 - 39738326
Alignment:
| Q |
198 |
taaaaataaaattaaactcttccgactgttatttgaatttttcgcttggttcttcccccttt |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39738265 |
taaagataaaattaaactcttccgactgttatttgaatttttcgcttggttcttcccccttt |
39738326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University