View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15022_low_24 (Length: 236)
Name: NF15022_low_24
Description: NF15022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15022_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37629187 - 37629407
Alignment:
| Q |
1 |
ttaaggtcctgagtttgagtcttgtgaacggnnnnnnnnntgtggatgagtgtttcacatgtatgatctgttaacnnnnnnnnntgatgattacaattta |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37629187 |
ttaaggtcttgagtttgagtcttgtgaacggaaaaaaaaatgtggatgagtgtttcacatctatgatctgttaacaaaaaaaaatgatgattacaattta |
37629286 |
T |
|
| Q |
101 |
ttgagattctaaattattcaagacaatgatgcaggaaatcaatgaaggaatttgctttgaagctagagacacttgcagaggagctactagacttattatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37629287 |
ttgagattctaaattattcaagacaatgatgcaggaaatcaatgaaggaatttgctttgaagctagagacacttgcagaggagctactagacttattatg |
37629386 |
T |
|
| Q |
201 |
tgaaaatcttggactagaaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37629387 |
tgaaaatcttggactagaaaa |
37629407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University