View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15023_high_31 (Length: 205)

Name: NF15023_high_31
Description: NF15023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15023_high_31
NF15023_high_31
[»] chr7 (1 HSPs)
chr7 (14-205)||(28122342-28122533)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 28122533 - 28122342
Alignment:
14 gaagagccaatttgtctatgagtaaggtcacatgccactgattgaatcccagaagtggttgatgttggggcatgatgatgagcagctaagtattgacgtg 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
28122533 gaagagccaatttgtctatgagtaaggtcacatgccactgattgaatcccagcagtggttgatgttggggcatgatgatgagcagctaagtattgacgtg 28122434  T
114 gatcaatactggacctctgttgttgcatggagaatgaaggttgtcccattgagtcgaaaagtgtagacatatcataggtgaccggcatggtt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28122433 gatcaatactggacctctgttgttgcatggagaatgaaggttgtcccattgagtcgaaaagtgtagacatatcataggtgaccggcatggtt 28122342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University