View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15023_low_16 (Length: 319)
Name: NF15023_low_16
Description: NF15023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15023_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 59
Target Start/End: Original strand, 23118931 - 23118966
Alignment:
| Q |
24 |
ccggagggtgatctggaggagtattaaattgctcaa |
59 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23118931 |
ccggagagtgatctggaggagtattaaattgctcaa |
23118966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University