View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15023_low_17 (Length: 318)
Name: NF15023_low_17
Description: NF15023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15023_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 53118391 - 53118499
Alignment:
| Q |
1 |
tgtatagtgtaaaatagaaattgacgtactgattgatagaaaattatatatttataaaatggcataaacatgctattaaatacgtcaatt-aatatatta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53118391 |
tgtatagtgtaaaatagaaattgacgtactgattgatagaaaattatatatttataaaatggcataaacatgctattaaatacgtcaattaaatatatta |
53118490 |
T |
 |
| Q |
100 |
taccgaaac |
108 |
Q |
| |
|
||||||||| |
|
|
| T |
53118491 |
taccgaaac |
53118499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 199 - 299
Target Start/End: Original strand, 53118593 - 53118693
Alignment:
| Q |
199 |
tcttatactcttattattcaacaaatgataataatttacactaactcttttctttgtgtgtacaatcagatcaaatgagtgtggtcacgtattcacatta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118593 |
tcttatactcttattattcaacaaatgataataatttacactaactcttttctttgtgtgtacaatcagatcaaatgagtgtggtcacgtattcacatta |
53118692 |
T |
 |
| Q |
299 |
t |
299 |
Q |
| |
|
| |
|
|
| T |
53118693 |
t |
53118693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University