View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_high_29 (Length: 324)
Name: NF15024_high_29
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 125 - 315
Target Start/End: Original strand, 14878620 - 14878809
Alignment:
| Q |
125 |
tttggattagtcccaatgattagttttcttagatcattattcaagataactatataattgactctgagtaatgatatgacacttgaaacaagtctattta |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14878620 |
tttggattagtctcaatgattagttttcttagatcattattcaagataactatataattgactctgagtaatgatatgacacttgaaacaagtctattta |
14878719 |
T |
 |
| Q |
225 |
tattcatggcattcataag-nnnnnnnnaaaggttattagctttcaaattacttaatttttatctcaaaataatatttataactcaaatatt |
315 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14878720 |
tattcatcgcattcataagtttttttttaaaggttattagctttcaaattacttaatttttatctc--aataatatttataactcaaatatt |
14878809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 14878459 - 14878503
Alignment:
| Q |
18 |
ggtaagagtttaactttgtctttaaggtatcaaacttgaatcctt |
62 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14878459 |
ggtaagagtttaactttgtctttaagatatcaaacttgaatcctt |
14878503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University