View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_high_42 (Length: 275)
Name: NF15024_high_42
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_high_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 4228736 - 4228983
Alignment:
| Q |
11 |
gatgaatatggcaataagatggaagagatgtaatgtgtttcctagaaaacatgatcatataaatgtgcatacaaatttattgagcgaattctaatttgta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228736 |
gatgaatatggcaataagatggaagagatgtaatgtgtttcctagaaaacatgatcatataaatgtgcatacaaatttattgagcgaattctaatttgta |
4228835 |
T |
|
| Q |
111 |
tgatgagcctatgctataatgtaagtccggctccacatcgaagtgattctattcaaagaagtatctcttagttaaaatttgaacattgattcatcatatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4228836 |
tgatgagcctatgctataatgtaagt-cggctccacatcgaagtgattctatttaaagaagtatctcttagttaaaatttgaacattgactcatcatatt |
4228934 |
T |
|
| Q |
211 |
gtttgagcatagtcttttatgttagactcatcctttattgattgaggtg |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228935 |
gtttgagtatagtcttttatgttagactcatcctttattgattgaggtg |
4228983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University