View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_high_43 (Length: 271)
Name: NF15024_high_43
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_high_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 6 - 163
Target Start/End: Original strand, 14908323 - 14908473
Alignment:
| Q |
6 |
agcagcacagattgctcggaagttaagaataaaggttaagaacccttgatactttgttcaaacgatgatgaactattttcaacttgagtgtgtattgtgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14908323 |
agcagcacagattgctcggaagttaagaataaaggttaagaacccttgatactttgttcaaacgatgatgaactattttcaacttgagtgtgtattgt-- |
14908420 |
T |
|
| Q |
106 |
ttgccgtttggaataatagttgtgagatactcgatcatcaaaacacagtccgagggta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14908421 |
-----gtttggaataatagttgtgagatactcgatcatcaaaatacagtccgagggta |
14908473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 198 - 252
Target Start/End: Original strand, 14908508 - 14908562
Alignment:
| Q |
198 |
gaagctgctattcttgatgtatcaattagtcttgtagaatcaatcatcacagatg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14908508 |
gaagctgctattcttgatgtatcaattagtcttgtagaatcaatcataacagatg |
14908562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 6 - 67
Target Start/End: Original strand, 14901560 - 14901621
Alignment:
| Q |
6 |
agcagcacagattgctcggaagttaagaataaaggttaagaacccttgatactttgttcaaa |
67 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
14901560 |
agcagcacagattgctcggaagttgagaataaagattaagaacccttgatacgttgttcaaa |
14901621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University