View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_high_47 (Length: 263)
Name: NF15024_high_47
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_high_47 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 263
Target Start/End: Original strand, 30785726 - 30785979
Alignment:
| Q |
5 |
agaagagagaagcagatagaagagcaactagagctgcactagacactgattcacccaatgataatgtgagtttctgagatgcttggtgattttgttttgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30785726 |
agaagagagaagcagatagaagagcaactagagctgcactagacactgattcacccaatgataatgcgagtttctgagatgcttggtgattttgttttgg |
30785825 |
T |
 |
| Q |
105 |
attggttccctgtgaagagtagtagagtgaaaattattaaacttgaataagagnnnnnnnntgattcatgaatataaacttgtatagtatagtatagtat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30785826 |
attggttccctgtgaagagtagtagagtgaaaattattaaacttgaataagagaaaaaaaatgattcatgaatataaactt-----gtatagtatagtat |
30785920 |
T |
 |
| Q |
205 |
acgaaccagaaacagagaaagaggagttggtgagttggttgaagaggaaggtgttgacc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30785921 |
acgaaccagaaacagagaaagaggagttggtgagctggttgaagaggaaggtgttgacc |
30785979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University