View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_high_48 (Length: 255)
Name: NF15024_high_48
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 49858539 - 49858783
Alignment:
| Q |
1 |
tgtaatagcacattcgagccattgtgttgcaggatgacgcgacataattgcatcgaatttcatattagactttgcgcagtacgagaatgtgacacataaa |
100 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49858539 |
tgtaatagcacattcaagccactgtgtcacaggatgacgcgacataattgcatcgaatttcatattagactttgcgccgtacgagaatgtgacacataaa |
49858638 |
T |
 |
| Q |
101 |
ggttgggtttctcgaatcacttcagtcgcaatatatgcattttatgtcataactaaacccaatctaagaggtttaatcacttggacatagttacacatat |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49858639 |
ggttgggtttctcgaatcacttccctcgcaatatatgcattttatgccataactaaacccaatctaagaggtttaatcacttggacatagttacacatat |
49858738 |
T |
 |
| Q |
201 |
gattagacttttcttagtgtaataccgccttcactcaagaataat |
245 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
49858739 |
gattagacttttcttagcgtaatactgccttcactcaagaataat |
49858783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University