View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15024_high_61 (Length: 202)

Name: NF15024_high_61
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15024_high_61
NF15024_high_61
[»] chr8 (1 HSPs)
chr8 (49-194)||(34994891-34995036)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 49 - 194
Target Start/End: Original strand, 34994891 - 34995036
Alignment:
49 taaatgattgggaaaatttgtctcgttcatagcatgattcgcttgtctatactgaaaaatctgcatgtgttggcattggttgatcgtcgagtaatatttg 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
34994891 taaatgattgggaaaatttgtctcgttcatagcatgattcgcttgtctatactgaaaaatctgcatgtgttagcattggttgatcgtcgagtaatatttg 34994990  T
149 tcaaaattgcaaaaagtgtgtctcaaatacaccttcttttcactcg 194  Q
    | |||||||||||||||||||||||||||||||||||||| |||||    
34994991 tgaaaattgcaaaaagtgtgtctcaaatacaccttcttttaactcg 34995036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University