View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_low_49 (Length: 270)
Name: NF15024_low_49
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 45671594 - 45671407
Alignment:
| Q |
15 |
gggctgttgcagacattgaagttacaatggtagatagtcatgccaacatgaaaattctatccaagaaaaaaccaggacaacttatgaagattgttgttgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671594 |
gggctgttgcagacattgaagttacaatggtagatagtcatgccaacatgaaaattctatccaagaaaaaaccaggacaacttatgaagattgttgttgg |
45671495 |
T |
|
| Q |
115 |
gttacaaaatcttaggcttaccattcttcatcttaatgttaccacggtcgatgatatggttctttactcagttagtatcaaggttagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671494 |
gttacaaaatcttaggcttaccattcttcatcttaatgttaccacggtcgatgatatggttctttactcagttagtatcaaggttagt |
45671407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 219 - 255
Target Start/End: Complemental strand, 45671388 - 45671352
Alignment:
| Q |
219 |
gaaattttaattagaagttaagtaattttgttaatta |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671388 |
gaaattttaattagaagttaagtaattttgttaatta |
45671352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University