View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15024_low_50 (Length: 266)

Name: NF15024_low_50
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15024_low_50
NF15024_low_50
[»] chr3 (1 HSPs)
chr3 (12-247)||(47715977-47716212)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 47716212 - 47715977
Alignment:
12 agagatatcagagaaagtaacgaaaccgaaacctctagggattcgggtggtgcggtcaaaagagatggtggagtgcaaaacgtcaccgtatttggtgaaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47716212 agagatatcagagaaagtaacgaaaccgaaacctctagggattcgggtggtgcggtcaaaagagatggtggagtgcaaaacgtcaccgtatttggtgaaa 47716113  T
112 tggtgtttgagagtgtcttcagtggtttcgcgagaaatgccacctacgaagagcttggctttatcagaatccattttgaaattcatggtactgtagatga 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47716112 tggtgtttgagagtgtcttcagtggtttcgcgagaaatgccacctacgaagagcttggctttatcagaatccattttgaaattcatggtactgtagatga 47716013  T
212 aaccctaaatccccaaatcaattggaaacccttact 247  Q
    ||||||||||||||||||||||||||||||||||||    
47716012 aaccctaaatccccaaatcaattggaaacccttact 47715977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University