View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_low_51 (Length: 264)
Name: NF15024_low_51
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_low_51 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 264
Target Start/End: Original strand, 34349968 - 34350223
Alignment:
| Q |
10 |
ataatactcctagaacaatcctttattaggcaannnnnnnn-cttcctaatcttttgagaagtgaatgagttccttatgtacagaatgggaaattctccc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34349968 |
ataatactcctagaacaatcctttattaggcaatttttttttcttcctaatcttttgagaagtgaatgagttccttatgtacggaatgggaaattctccc |
34350067 |
T |
 |
| Q |
109 |
atgtgagagaaccatatactatatagagctttgtgaaattcgaagtgctttataaattgttcactaaattgattcttaagtctatatatggatggattct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
34350068 |
atgtgagagaaccatatactatatagagctttgtgaaattcgaagtgctttataaattgttcactaaattgattcttaagtctgtatatgaatggattct |
34350167 |
T |
 |
| Q |
209 |
cttgtcggggtttcaagtttgtctgaatttcttgttcttgatttctcttttcagat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34350168 |
cttgtcggggtttcaagtttgtctgaatttcttgttcttgatttctcttttaagat |
34350223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University