View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_low_56 (Length: 251)
Name: NF15024_low_56
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 35208979 - 35208763
Alignment:
| Q |
13 |
gtagcataggaatgggagaaaggattcaagtatatggtaccaaccttggctagttggcttcgtatcttggcaacaactactcatcatttggagtgtccac |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35208979 |
gtagcataggaacgggagaaaggattcaagtatatggtaccaaccttggctagttggcttcgtatctt---aacaactactcatcatttggagtgtccac |
35208883 |
T |
|
| Q |
113 |
atatcactgtttcatatttaatggtcacaacttaactcagaagcaatgaaatatagagctaattaatggactctttgaccataacacaacgatagggata |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
35208882 |
atatcactgtttcagatttaatggtcacaacttaactcagaagcaatgaaatatggagctaattaatggactctttgaccataacacaaccataaggata |
35208783 |
T |
|
| Q |
213 |
tttaatactccatgacatgc |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35208782 |
tttaatactccatgacatgc |
35208763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 144
Target Start/End: Original strand, 32208398 - 32208447
Alignment:
| Q |
95 |
atcatttggagtgtccacatatcactgtttcatatttaatggtcacaact |
144 |
Q |
| |
|
||||||||||||| ||||||||||| ||| || | ||||||||||||||| |
|
|
| T |
32208398 |
atcatttggagtggccacatatcaccgttgcagacttaatggtcacaact |
32208447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University